When Good Patents Go Bad 220
will writes "The Washington Post has a good
review of patents in the information age. The insanity of the US
patent system has been chronicled on this site numerous times in the
past (for example, an
FTC report on patent policy, some patents for obvious applications
such as Microsoft
patenting local weather, and Amazon patenting inside
book searching). The Washington Post article does a good job
of overviewing IP issues today, why the current US patent systems
fails in the information age, and gives an example of patent
extortion. Excuse me while I patent
my DNA."
The Washington Post's web patent (Score:5, Funny)
Re:The Washington Post's web patent (Score:5, Insightful)
Re:The Washington Post's web patent (Score:2)
As long as you make sure that your "apparatus" has length, width, and depth, you are safe f
Re:The Washington Post's web patent (Score:2)
BZZT! When using the predicate word "comprising" the patent limitations are closed-ended. Thus, as long as the body portion has a length and a width, you are covered. The existance of other elements, such as depth, does not effect the patent coverage.
What makes a bad patent? (Score:5, Insightful)
It could always be worse (Score:3, Funny)
Re:What makes a bad patent? (Score:2, Insightful)
Re:What makes a bad patent? (Score:2)
Re:What makes a bad patent? (Score:2, Insightful)
Let's see, inventors in the third world working to try and develop new ways of purifying water or meeting other basic human needs; Open source developers (ok, I know there are problems with software patents...); I could list more, but the reasons people invent is much greater then just for financial returns.
There is still a very large majority of people who are happy to work on things for the sense of improving others lives or simply the sense of achievment a creative act brings.
Re:What makes a bad patent? (Score:3, Insightful)
Not what was said. You have arbitrily added the condition "people who would like to invent something"; which is probably better stated as "people who intend to invent something"
First, if I know I lack the resources to invent something useful, but believe I could copy it once seen in action, why wouldn't I be against patents? At
Re:What makes a bad patent? (Score:5, Interesting)
You're honestly of the impression that there is actually a sizable minority of people who would like to invent something with no guarantee to their right of exclusive production?
I work as a EE in a company and I've been in this situation myself before. I've become so disgusted with the patent process that I've decided that I'm not filing any more patents. If I was working independently as an entrepreneur I might have a different opinion - and it is my belief that that is the real justification behind patents - to protect the entrepreneur long enough to get their product to the market.
However the patent system today doesn't serve to protect individuals, its now nothing more than a corporate club for litigation against any would be competitors. Its used by companies that are already well established and are in no danger of not getting a product to market. I remember someone once telling me the way patent settlements are reached is that the lawyers all gather in a room and the companies put their stacks of patent papers side-by-side, the difference in height yields the settlement fee. More recently there has been a trend towards reviving old patents on things that are obvious or have been in use for decades (ie. Forgent's "jpeg" patent). Its nothing more than a money grab by parasites abusing the patent system.
So back to the original point, yes I've invented things before - but no I don't care if the company I work for gets exclusive rights to it. You see it takes time and effort on my part to file a patent, and what do I get for my efforts - a small wad of cash, big freaking deal. Now on the other hand if I don't patent it, I get to take that knowledge and use it again, for myself or for any other company I work for. Further as soon as the circuit I worked on gets fabricated, it becomes prior art and can no longer be patented after that. Its a selfish motive on my part (no more selfish than the patent grabbing company though), but in the end my method serves myself and everyone else better (well at least the people I work with since they get direct benefits of that prior knowledge)...
Re:What makes a bad patent? (Score:2)
I've decided that I'm not filing any more patents. If I was working independently as an entrepreneur I might have a different opinion
I see. You're willing to stand up for principle, as long as it aint your buck on the line.
Re:What makes a bad patent? (Score:2)
Every single inventor of anything before 1960.
Now how about you attempt the reverse and much harder problem, and find me someone who decided he did not want to invent because he wouldn't get a patent.
Re:What makes a bad patent? (Score:5, Interesting)
Or in other words - "is it a great wonderfull new idea rather than just an incremental change that would be obvious to any engineer faced with the same problem?"
IMHO probably one of the worst problems with the current patent system is the inability of the patent examiners to judge the "obvious to a practioner of ordinary skill in the field" test. A few years back I was engaged on an x86 cloning project .... it's a patent minefield, with the spectre of Intels lawyers looming at every term .... we came up with a wonderfull (though complicated) way to get around one of Intels primary (and IMHO obvious, with prior art) patents .... only to have a patent appear from a 3rd company with exactly the same solution ... since both companies had come up with the same solution faced with the same problem boxed in by the same Intel problem patent I would argue that the solution was obvious to "ordinary computer architects" at the time ... but there's no way I can see for a patent examiner to know or understand that - and since there's no way to bring these issues up untill after the patent has been granted - which means going to court ....
The patent minefield isn't really getting any bigger ... it'sm just that the mines keep getting closer together ...
Re:What makes a bad patent? (Score:5, Insightful)
Few of Edison's own patents meet that test. The phonograph may have been new, but the light bulb (his most famous invention, in 1879) had already been created by others as early as 1841. His own modifications were incremental. Yet of course he still got a patent.
Other legendary inventors who did incremental changes to existing ideas (followed by the inventor who made the original, but less efficient device):
Arguably, however, patents are better given to someone who makes an incremental improvement, rather than a revolutionary one. Patents (and all of "Intellectual Property") are only meant to encourage progress. Genius, heroic inventors are quite likely to pursue their insight regardless of the prospect of patent protection- and if they succeed and earn a patent, it's likely to take a decade or more before the concept really becomes profitable. Potential competitors will be slow to recognize and accept the totally new idea.
The phonograph and airplane, for example, both had patents granted for them, and both became huge industries (one with annual revenue in the billions, the other in the trillions). But the patents were almost expired before the business models really started to get into wide-scale profitability.
But, an incremental improvement is more vulnerable to being rapidly duplicated. Someone prespiring away at finding the right combination of gas and filament to make the light-bulb really practical runs a true risk of someone else buying his first product and starting to sell a reproduction just 3 months later.
A much fairer patent system would give the examiner more options than just a yes/no response. Not all inventions are inherently deserving of the same length of protection. If the government recognized this, the assignment of bad patents would be far less damaging, as only the best patents would get the long, multi-decade terms.
Software patents especially (if they are allowed to exist at all) show last much shorter than those for physical machines. Suppose the Amazon 1-click patent had lasted for just 2-3 years. That'd be not nearly as bad as the prospect of continuing to avoid one-click ordering in 2017.
Re:What makes a bad patent? (Score:3, Interesting)
Personally, I doubt that any standard of patentability is high enough, duration short enough and scope narrow enough to make a patent system worth more than the value of the competition and incremental development that
Re:What makes a bad patent? (Score:3, Interesting)
Don't discount the revenue of advertisers to retailers. If Amazon is anything like most grocery/department stores, they get a lot of money for product placement. When I was just out of high school, I worked for a company that was paid to go around to grocery stores, take down a bunch of product from the shelves and put it back up in a different order. Why? Because the stores don't own the layout on the shelves - certain products do (in my case, Gi
No. What makes a GOOD patent? (Score:2, Insightful)
In my view, there should be only one rule: "Would X have been invented without the 20 years of protection from competition provided by patent law?"
There is absolutely no reason for society to allow patents for inventions that don't pass this simple test.
Re:No. What makes a GOOD patent? (Score:2)
A list of some other ridiculous patents... (Score:5, Interesting)
Another reason for ridiculous patents (Score:5, Interesting)
Re:Another reason for ridiculous patents (Score:5, Informative)
A challenge phase needs to be put in place so that our patent killers (as well as competitors) have a chance to savage a patent with prior art claims before it officially goes on the rolls.
Finally, we need new categories of IP that try to make things a little more clear. Copyright and Patent no longer covers the range of intellectual property out there.
Patent - Applies only to physical machines. Applies specifically to a problem and the machine that solves it.
Copyright - A written and performed work of art. Computer programs do NOT apply.
Software (4 years)- A very specific process for creating something new. Data structures may be involved, but only in conjunction with a related algorithm. Alternative methodoligies for using the same data formats (reverse engineering) is specifically allowed.
Method/Application Patents (4 years) - Protect a novel way of doing something. This may apply to a business method or a software application.
Pharma (15 years) - A chemical composition for curing a specific ailment or modifying a biological process. All Pharma patents must be vetted. That is, the research must be done showing that it actually does what it CLAIMS it does.
Pharma Use (non-exclusive 10 years) - A set of research that proves an additional use for an Pharma substance. This could apply to something as mundane as aspirin. A court could grant intellectual property rights proportional to the scope of a new use for that substance which would increase it's use. For example, proving that Aspirin helps prevent heart attacks increases the use of Aspirin.
This one sounds weird, but it encourages people to do more research on existing substances. Pharma research is EXPENSIVE. This research should be rewarded since it adds to the level of human knowledge and increases the use of EXISTING products making the whole process more effecient.
The IP would work as a royalty granted by IP courts levied on producers of that substance.
Research patents (non-exclusive 10 years) - Like Pharma patents, this would expensive basic research. It would be a royalty applied to products which profit from knowledge derived from expensive research.
The most obvious IP in this area would be human and animal genome. It's not an invention, it's an expensive process of discovery. Additional types of IP could relate to materials science, and even advanced physics (like the guys slowing light down, quantum entanglement methods (advanced communications)).
Engineered Organisms - A company that engineers an organism would have rights to re-produce and sell that organism. Any one else with access to that organism could breed it, but not for profit.
Re-production of the organism using unique methodologies would be allowable and would constitute a unique organism IP. Though, other IPs may apply.
New IP categories. The IP office would have staff and processes devoted to exploring new categories of IP and their associated rights, and fees. They could write legislation and submit it to congress for consideration and ultimate approval.
Re:Another reason for ridiculous patents (Score:5, Interesting)
Pharma (15 years) - A chemical composition for curing a specific ailment or modifying a biological process. All Pharma patents must be vetted.
-----
Background...
-----
That is, the research must be done showing that it actually does what it CLAIMS it does
-----
Have you heard of angiogenesis inhibitors? They are chemical compounds which battle cancer by preventing tumours from growing additional blood vessels. If the tumour cannot grow more blood vessels then it, theoretically, will starve itself into remission.
I was at a project meeting one time where the department head was singing the praises of the latest round of developmental angiogenesis inhibitors. He was pointing specifically to data from mouse models which showed that, after the compound had been introduced to a mouse with a tumour, the tumour decreased in size and entered remission as opposed to mice who had been given a placebo. The size of the tumour was determined by cutting it out of the mouse and using a balance to determine its mass.
To verify that the compound was doing what it was supposed to be doing I asked if anyone checked the vasculature in the tumour. Were the veins and arteries smaller or thinner? Was there evidence that the tumour decreased in size due to reduced vasculature? Was there any evidence that the compound was working as an "angiogenesis inhibitor" and not by another mechanism? The department head looked like a fish out of water for five seconds and then began a 30 second rant about how I was an incompetent fool that needed to go to graduate school before I understood anything about biochemistry.
Needless to say the company was still pursuing filing a patent for the new "angiogenesis inhibitors" when I left. It never ends.
The lawyers will win. (Score:5, Interesting)
This is going to be a giant windfall for the lawyers in all this as there will have to be an overhaul of the patent laws and system.
Here's a prediction too: after the "fecal matter hits the rotary cooling device" in all this patent fiasco you'll see an increase in the number of people going to law school. Mainly for IP law, too. Don't laugh, remember how the non-geek masses took computer science in the 90's because that's where the money was?
Arn't we allready there? (Score:4, Informative)
So are more lawyer really the anwser?
They are for the Killbots (Score:2)
with apologies to Matt Groening and Futurama
Re:The lawyers will win. (Score:4, Funny)
Re:The lawyers will win. (Score:2)
Re:The lawyers will win. (Score:2)
You gave me too many ideas... too much caffeiene in my bloodstream...
Patent the process for using the Internet as a communicati
Re:The lawyers will win. (Score:2)
Re:The lawyers will win. (Score:2)
If only the lawyer-maiming business was so lucrative.
Why is it when a bug is found in software it's fixed (with notable exceptions), but when bad laws are written, they're left to afflict everyone?
It's time to Open Source law, and require politicians to be picked randomly with a term limit of 2 years.
Re:The lawyers will win. (Score:2, Funny)
3 figure? Was he from India?
Re:The lawyers will win. (Score:2, Insightful)
All I can say is... (Score:5, Insightful)
Re:All I can say is... (Score:5, Insightful)
Yes, [debian.org] there [gnu.org] are [kernel.org].
Re:All I can say is... (Score:4, Interesting)
Re:All I can say is... (Score:3, Informative)
It's a classic Catch-22 situation - attempting to capture the value destroys the value.
Re:All I can say is... (Score:2)
>>Douglas Englebart first described hyperlinks in his seminal work in the 1960s...makes you wonder how hard they really look for prior art--i found a link to confirm my facts about DE on google in about 2 seconds...
Well go back to 1976 and try to run a google search then.
I patent.... (Score:4, Funny)
What's the story about?
Re:I patent.... (Score:4, Funny)
I just have one question for the writer. (Score:3, Informative)
Would that be YOUR DNA, or your clones'?
Re:I just have one question for the writer. (Score:4, Funny)
Patenting DNA? (Score:3, Insightful)
If they are patenting "hey I figured out what strand GCACTCTGATCTGTCTATATGTGT does" it's garbage.
If, however, they figured out what sequence of nucleotides happens to build a molecular machine that does X (where X is something new) then a patent might be arguable. The *might* comes from the fact that I think they should patent the molecular machine, not the method of making it. After al
Comment removed (Score:4, Insightful)
My views (Score:4, Insightful)
Some ingenious ideas , need to be patented so that the inventor can reap the benefits of his hardwork. But inventions which leave us saying "f@#king DUH!", should seriously be quentioned.
What USofA needs is a better patent challanging system. and by challanging a patent I don't mean claim ownership of that patent, I mean demonstrate the use of that idea so commonly in public domain, that no one actually deserves the patent.
Re:My views (Score:4, Insightful)
Re:My views (Score:2)
Sadly the patent wordings most of the time are so vague or catch-all, that the inventor gets credit for more that he deserves.
This is especially true for software patents
One problem with many patents.. (Score:5, Interesting)
For example, as a chemist, I search the patent literature trying to find out what chemical reactions have been reported. It is a well-known fact that you have to take the chemical patent literature with a huge grain of salt (no pun intended!) because many times, the reaciton simply doesn't work the way it is reported to work. The chemical patent literature is not a peer-reviewed process like scientific journals are. It is significantly harder to get an article published in the chemical literature than to patent that material.
I guess what I am getting at, is that there is rampant patenting taking place with few significant things to show for it. Chemists patent anything and everything they can in the off-chance that someone will use it in an industrial process. They are just total fishing expeditions. I know that there will certainly be people out there to correct me with their own opinion, but in my opinion, it just points to a flawed patent system.
Re:One problem with many patents.. (Score:2)
One idea that could be a step toward a fix for this problem -- and it's not just with chemistry patents -- is to require that a company holding a patent actually be using that patent in a product. It's not an ironclad solution, nor does it solve all of the problems with
Re:One problem with many patents.. (Score:3, Interesting)
No, I don't think this is the solution. First of all, individuals hold patents, not companies. And, secondly, often the idea for the invention requires investment for implementation.
But I think requiring a working implementation within some liberal period, say, 3 years, after the patent is granted would be usef
Bitter Protest against Patents (n copyrights some) (Score:4, Insightful)
Surely anyone who claimed that there is no incentive go grow cotton without "niggers" on the plantation would be considered a barbaric. But if someone claims that there is no incentive to create intellectual and knowledge works without copyrights and patents, then society calls them enlightened. If someone had said that the great wealth of America rested on slavery as a property right and the plantation system, they were a foolish idiot. But if someone says that the great wealth of societies in the information age rests on "Intellectual Property", then they are called wise. Anyone who says that slavery was about property rights and not control, is a liar. However, if they say that copyrights and patents are not about control, but "Intellectual Property" then they are considered trustworthy. How about - if you don't like slavery - don't own slaves, and if you don't like copyrights no one forces you to buy those creations. How about - if you don't believe in slavery, you must be an anarchist, if you don't believe in copyrights and patents you must be communist. How about - you are a thief if you free slaves from the plantation, you are a thief when you copy someones "Intellectual Property".
So why are we spoon-feed these poor logical explanations over and over again? Because, like the rapist who drugs his victim and gently penetrates her, rather than beat her and tear into her where all the scars, blood, and bruises can be seen. Like the assassin who befriends and mis-places his victims heart medications, rather than pull out a rifle and pop a bullet in the head. Copyrights and patents are the pinnacle of quiet violence. So seemingly innocent, so seemingly civilized and friendly, so hard to see and identify any direct evil, any direct consequence. After all, what could be less harmless then providing an incentive to artists and inventors, right? But do they really promote art - or just promote works that have the most hype rather than the most meaning and educational value? Do they really help inventors, or do they hinder collaboration and sharing in a way that would put a police state to shame?
Perhaps the old lady has none to blame when her patented diabetes medication is too expensive to afford anymore. Who can the workers blame when the proprietary technology they bet their career on becomes obsolete and it becomes ever harder to relearn from scratch as they get older. Who can a child in Africa blame when they are dying of AIDS, and there are no generics to treat it! Who do we blame when researchers seeking a cure for cancer encounter massive obstacles to sharing there individual research for fear that their peers will get one up on them, get a key patent, and lock them out! Who do our nations students blame when tabloids are pennies on the dollar, but textbooks dollars on the page! Who do we blame for Hollywood culture being such a failure, and so strongly influencing society in their own failed image.
As people die because patented medicines are too costly and alternatives too sparse, and the needy go without, not because of genuine shortage, but because artificial human made restrictions. Our government who is the enemy of overt violence, has become the friend of quiet violence. Our government who has organized world wars to protect our freedoms, now promotes a world order that will take them away. The democracy that has allowed us to fight for our rights with votes and politics rather than violence and bloodshed has now become
Re:Bitter Protest against Patents (n copyrights so (Score:2, Funny)
Re:Bitter Protest against Patents (n copyrights so (Score:3, Insightful)
A more apt analogy for cotton with regards to copyright would be:
"There would be no incentive to grow cotton if no one would _buy_ cotton, because they could get it for free. "
I know that it isnt possible to get cotton for free, but you have to understand that it IS possible with regards to most copyrighted works.
Your slavery argument when
Re:Bitter Protest against Patents (n copyrights so (Score:2)
"No one will produce Open Source because they can get it for free."
Right????
Re:Bitter Protest against Patents (n copyrights so (Score:2, Interesting)
arguments for (Score:3, Interesting)
People may complain about abuse, but isn't it better that via the patent system, people disclose their inventions instead of hiding behind trade secrets, thus allowing others to improve upon the inital invention? I would expect that people here
Re:arguments for (Score:3, Insightful)
If there are no software patents, investors cannot require them. It's really as simple as that. Software patents are the .com hype all over again: companies are not supposed to have a good product, good customer relationship management or even
Re:Bitter Protest against Patents (n copyrights so (Score:2, Insightful)
The comparison to slavery pisses me off and it should everyone here. To put copyright/patent legislation on the same level of importance with human slavery is utterly immoral and academically incorrect. Not only does it reek of propaganda (in your next article, you might as well claim that Hitler would have supported patents), but they have zero to do with each other. From a purely economic perspective, slavery was
Re:Bitter Protest against Patents (n copyrights so (Score:2)
I was about to slam you for plagiarising (from here) when I noticed that you're the same person. Makes a change.
he he he, guilty as charged. Last time when i posted my "bitter protest against copyrights" on slashdot, the owner of the site like it so much that he asked if he could post it there. So This time I posted my bitter protest against patents there first.
ps: if you agree with this protest, you'll probably like that one too.
Re:Holy shit (Score:2)
I was trying to find holes in the IP/HP (human property) argument, but I failed...
The reasoning behind that is very simple. It's because it has nothing to do with property - it is about controll and violence. Perhaps they use different terminology, perhaps different labels, perhaps different details and techniques, but the logic and rational is the same as has been pushed for 1000's of years by tyrants, dictators, and the greedy. Once you see it, the facts speak for themselves.
Re:IP/slavery meme (Score:4, Interesting)
Actually there is a story behind this. It was at a time when i was doing alot of thinking about copyrights, but every time i thought about the problems with copyrights - some of the logic - it sounded like somthing i had herd before. I finally came up with an essay comparing it with slavery and sent it to RMS. Believe it or not, he replied, and said somthing like I should be carefull because the suffering caused by slavery was far more atricious than what is suffered by copytights. Like more often than not, he was right.
So anyhow I was chewing on that for awhile, and long behold a week later I stumbled upon an article in the berkley daily planet writen by a pharmacutical exec trying to justify some AIDS patent lawsiuts against africans. The arguments that they had no incentive without patents, and that they were generous to Africans sure sounded like there was no incentive to grow cotton, and we are kind to our slaves on the plantation. From my history lessons.
The meaning of the 1850s today, the quiet violence, the nature of rights, the historical perspective, all those have stories too - but i just dont have time to elaborate here.
information patents: life as info (Score:5, Interesting)
They started as an agriculture research and advocacy group (RAFI) and morphed into ETC about the time they started discovering how broad the patenting system's enclosure of life forms and genetic structures was getting. It's an issue with huge implications, since ideas, biological structures, and living beings are being patented in sometimes outrageous ways [etcgroup.org].
Re:information patents: life as info (Score:2)
uuuh
Define:
v. procreated, procreating, procreates
v. tr.
To beget and conceive (offspring).
To produce or create; originate.
Gillettes new razor 37 has patents (Score:4, Funny)
Re:Gillettes new razor 37 has patents (Score:2)
I still think the best solution is to limit how long patents - particularly IT patents - have to live. A few years of profit on innovation are fine, but a lifetime is absurd.
Re:Gillettes new razor 37 has patents (Score:2, Informative)
Re:Gillettes new razor 37 has patents (Score:2)
x86, tcp/ip, some random ibm patents contrast this to how much has failed. Generally after about 4 years any neat idea isnt profitable, even 2 years would be fine.
I personally would like to see software patents have a choice of:
submit full working sourcetree, source is released with the patent expiration after 5 years.
No source, Patent expires after 8 months.
Copyright it, not Patent your DNA (Score:5, Funny)
Sure to insure domestic tranquility.
Re:Copyright it, not Patent your DNA (Score:2)
So you'd only really have a case in a situation where more than 50% of the copyrighted genes were used - e.g., a double Y chromosome or something. Even then, I think you'd have trouble getting any sympathy from a jury. Of course, with good representation, anything is possible, I guess
A better trick (Score:2)
Then, just as the patent is going to run out, start suing for unauthorized use of your GIF^H^H^H DNA format.
America's Goofiest Patents (Score:5, Interesting)
Categorized and arranged alphabetically in all their royal glory.
My favorite: The Blind Spot Toy [totallyabsurd.com]:
USA patent 4,477,3358 / Issued 1994
It is never too early to start your Christmas holiday shopping. Why not be original this year and avoid the toys that everyone seems to be buying? Why not give the gift that keeps on giving, the "Apparatus for Aligning Image with Blind Spot of the Eye"!! Patented in 1975, this toy allows the user to locate their blind spot! In order to play this amazingly fun game, strap the toy tightly on the top of your head.
Close your left eye and focus on the dangling tab with your right eye, then switch eyes. Voila! The dangling tab has disappeared into your blind spot. Not only will this invention provide endless hours of fun and good times for everyone (especially at parties), but anyone wearing this apparatus will unquestionably become irresistible to the opposite sex. Enjoy!
Rerun (Score:5, Funny)
This is a rerun. I saw this on Fox a couple of weeks ago.
Good Review? (Score:2, Interesting)
Is it good because it agrees with the Slashdot point of view?
Just ask IBM, Microsoft, Amazon, what they think of patents. I doubt they'll like this article very much.
I can already see it...-12, troll.
Pertinent link : bustpatents.com (Score:3, Informative)
DNA Patents (Score:2, Funny)
"Thanks for being my prior art, Dad. Happy Birthday."
Generic... (Score:3, Interesting)
Software patents extremely grey area (Score:3, Insightful)
How about the guy with the patent on the blinking cursor? Great ideas, right? So, where does the line get drawn? Obviously, patenting something already in use is bad, but what about really obvious things that no one bothered to do yet?
For years, Ford had to pay a different company for a patent on the internal combustion engine. They literally had to wait for the patent to run out!
Prior Art (Score:2)
Why VisiCalc wasn't patented (Score:5, Interesting)
The bad news is that Bricklin thinks software patents are bad, but since they are here, you have to try to patent as much as possible. I guess soon we will have to take out patent-infringement insurance with premiums as high as our salaries.
From the Desk of Dr. Evil (Score:2, Funny)
How about my design for Dolphins with Frikken Laser Beams Attached to Their Fins [robertkbrown.com]?
D. Evil
One Click Local Weather reports (Score:4, Informative)
After I finished, it was a _tough_ one night hack, the thought occurred to me that some folks have patented less (ie One click shopping, local weather etc.). It demonstrated to me the need to be change the patents laws to prevent the locking up of obvious or trival application of emerging technology.
Re:One Click Local Weather reports (Score:3, Interesting)
I have not had the time to dial in all open source browsers, but will as time permits.
When a store spams you wit
Re:One Click Local Weather reports (Score:2)
Re:One Click Local Weather reports (Score:3, Insightful)
My overall point is "ya sure it is a gimmick" but some similar gimmicks have been patented and they should not.
At least USPTO admits it... (Score:3, Funny)
This may explain why so many bad ones get granted?
Acacia (Score:5, Insightful)
It was a very clever strategy on the part of Acacia - first go after the porn folks (nobody would come to their defense), then the university and online education folks (no money to fight), then the broadcasters (already under siege by the trade associations), then the toolmakers. They probably could have been nipped in the bud if people had paid attention early on.
At this point, it's important to drag the big players into the fight - folks who are being sued by Acacia need to subsequently sue the tool vendors (Microsoft, Real, Apple, Macromedia) for selling them allegedly unlicensed patented technology.
Re:Acacia & prior art? (Score:2)
I know I developed several prototype streaming media systems at Apple in 1986-1987 that used Appletalk, and one of my coworkers did a TCP/IP port of one of these experiments. I don't how widely shown this stuff was. Farallon did a screen sharing system that is still available called Timbuktu that did streaming/multicasting too.
I also did some object-oriented streaming media stuff at Kalieda Labs, but that was the early 90s & MPEG was already on the radar.
-- Ja
EU patent law campaign (Score:5, Informative)
Let's hope we get the law as the EU parliament framed it....
Microsoft Patents Ones and Zeros (Score:2, Funny)
all the way from back in 1998, and still the all-time funniest parody on patent madness...
Anti - Patents? (Score:5, Interesting)
Totally agree (Score:2)
Business guys (Score:2, Interesting)
Patents and copyright (Score:2, Interesting)
The two protections were designed to be used for different purposes. copyright for IP, patents for inventions.
When you allow both types of protection to be applied to one piece of work, the result is strangulation of innovation.
We need to decide if software should be copyrighted, or patented. It can't be both. It isn't fair to the human race and isn't in anyone's best interest except the software companies (som
There really isn't a justification for Software... (Score:2, Insightful)
The whole purpose of the patent system was designed to provide an incentive(payment) for a company to willingly incrue the costs associated with the research and design of a new product. That incentive came in the form of a patent (guaranteed monopoly for 20 years) to recover the associated costs that went into research and design.
In software, although there are certainly costs incrued in the f
Disagree (Score:2, Interesting)
You've chosen a trivial example (one-click shopping) which probably should never have been awarded a patent in the first place due to its obviousness.
Second, I don't like that term "software patent". You don't patent software, you patent algorithms and methodologies which can be implemented in software. Many of the algorithms, however, could conceivably be implemented through something other than through the running of a software program.
The economics of developing new algorithms are no
The really scarey part (Score:4, Interesting)
We have created a monster and that should be obvious to all. Yet other nations and regions are considering it. What a nightmare.
Re:Patents (Score:2, Funny)
I trademarked goatse while you were distracted.
Public domain incompetence (Score:2)
Re:Public domain incompetence (Score:2)
Re:Cool. You can patent everything today! (Score:2)