Forgot your password?
typodupeerror
Patents United States

When Good Patents Go Bad 220

will writes "The Washington Post has a good review of patents in the information age. The insanity of the US patent system has been chronicled on this site numerous times in the past (for example, an FTC report on patent policy, some patents for obvious applications such as Microsoft patenting local weather, and Amazon patenting inside book searching). The Washington Post article does a good job of overviewing IP issues today, why the current US patent systems fails in the information age, and gives an example of patent extortion. Excuse me while I patent my DNA."
This discussion has been archived. No new comments can be posted.

When Good Patents Go Bad

Comments Filter:
  • by corebreech ( 469871 ) on Thursday December 11, 2003 @11:59AM (#7690185) Journal
    Here. [uspto.gov]
    • by Zog The Undeniable ( 632031 ) on Thursday December 11, 2003 @12:09PM (#7690291)
      Seriously, that's a good example of the proper use of a patent - for ingenious hardware widgets. IP patents, on the other hand, are downright evil.
    • From the patent:

      What is claimed is:

      1. An apparatus for threading a web through a printing press, comprising:

      a body portion having a length and a width; and

      at least one ridge integrally formed on at least one surface of said body portion, said at least one ridge extending along the length of said body portion, wherein said at least one ridge includes intermittent gaps affording flexibility to said body portion.

      As long as you make sure that your "apparatus" has length, width, and depth, you are safe f

      • As long as you make sure that your "apparatus" has length, width, and depth, you are safe from this patent.

        BZZT! When using the predicate word "comprising" the patent limitations are closed-ended. Thus, as long as the body portion has a length and a width, you are covered. The existance of other elements, such as depth, does not effect the patent coverage.

  • by mgcsinc ( 681597 ) on Thursday December 11, 2003 @12:01PM (#7690198)
    One aspect seems central to many of the patents which are generally accepted to be absurd or insane: they are patents on processes for selling goods or services rather than on the goods and services themselves or their means of production. There doesn't seem to be enough awareness of this discrepancy between these types of patents and ones which we consider to be reasonable. Online retailers such as Amazon, for example, may claim that they have two customer bases, book-buyers and advertisers, and that the website itself is a product for the advertisers, but in truth their real customers would seem to be the former....
    • by Anonymous Coward
      I'm waiting for someone to patent "A technique of stretching the rectum to a dangerously distended size with the purpose of photographing it in such a manner that it can be displayed on a network of computers in order to spread the photographs to unsuspecting users."
    • by Anonymous Coward
      There doesn't seem to be enough awareness of this discrepancy between these types of patents and ones which we consider to be reasonable.
      Careful with that "we"; there are many people who don't think any patents are reasonable.
      • You're honestly of the impression that there is actually a sizable minority of people who would like to invent something with no guarantee to their right of exclusive production? Find me one!
        • Let's see, inventors in the third world working to try and develop new ways of purifying water or meeting other basic human needs; Open source developers (ok, I know there are problems with software patents...); I could list more, but the reasons people invent is much greater then just for financial returns.

          There is still a very large majority of people who are happy to work on things for the sense of improving others lives or simply the sense of achievment a creative act brings.

        • You're honestly of the impression that there is actually a sizable minority of people who would like to invent something with no guarantee to their right of exclusive production?

          Not what was said. You have arbitrily added the condition "people who would like to invent something"; which is probably better stated as "people who intend to invent something"

          First, if I know I lack the resources to invent something useful, but believe I could copy it once seen in action, why wouldn't I be against patents? At

        • by dslbrian ( 318993 ) on Thursday December 11, 2003 @01:29PM (#7691044)

          You're honestly of the impression that there is actually a sizable minority of people who would like to invent something with no guarantee to their right of exclusive production?

          I work as a EE in a company and I've been in this situation myself before. I've become so disgusted with the patent process that I've decided that I'm not filing any more patents. If I was working independently as an entrepreneur I might have a different opinion - and it is my belief that that is the real justification behind patents - to protect the entrepreneur long enough to get their product to the market.

          However the patent system today doesn't serve to protect individuals, its now nothing more than a corporate club for litigation against any would be competitors. Its used by companies that are already well established and are in no danger of not getting a product to market. I remember someone once telling me the way patent settlements are reached is that the lawyers all gather in a room and the companies put their stacks of patent papers side-by-side, the difference in height yields the settlement fee. More recently there has been a trend towards reviving old patents on things that are obvious or have been in use for decades (ie. Forgent's "jpeg" patent). Its nothing more than a money grab by parasites abusing the patent system.

          So back to the original point, yes I've invented things before - but no I don't care if the company I work for gets exclusive rights to it. You see it takes time and effort on my part to file a patent, and what do I get for my efforts - a small wad of cash, big freaking deal. Now on the other hand if I don't patent it, I get to take that knowledge and use it again, for myself or for any other company I work for. Further as soon as the circuit I worked on gets fabricated, it becomes prior art and can no longer be patented after that. Its a selfish motive on my part (no more selfish than the patent grabbing company though), but in the end my method serves myself and everyone else better (well at least the people I work with since they get direct benefits of that prior knowledge)...


          • I've decided that I'm not filing any more patents. If I was working independently as an entrepreneur I might have a different opinion


            I see. You're willing to stand up for principle, as long as it aint your buck on the line.
        • Find me one!

          Every single inventor of anything before 1960.

          Now how about you attempt the reverse and much harder problem, and find me someone who decided he did not want to invent because he wouldn't get a patent.
    • by taniwha ( 70410 ) on Thursday December 11, 2003 @12:41PM (#7690615) Homepage Journal
      I've always thought that a great patent should pass the Edison test: "do you think that your patent would impress Edison?" (assuming Edison was up on modern technology etc etc).

      Or in other words - "is it a great wonderfull new idea rather than just an incremental change that would be obvious to any engineer faced with the same problem?"

      IMHO probably one of the worst problems with the current patent system is the inability of the patent examiners to judge the "obvious to a practioner of ordinary skill in the field" test. A few years back I was engaged on an x86 cloning project .... it's a patent minefield, with the spectre of Intels lawyers looming at every term .... we came up with a wonderfull (though complicated) way to get around one of Intels primary (and IMHO obvious, with prior art) patents .... only to have a patent appear from a 3rd company with exactly the same solution ... since both companies had come up with the same solution faced with the same problem boxed in by the same Intel problem patent I would argue that the solution was obvious to "ordinary computer architects" at the time ... but there's no way I can see for a patent examiner to know or understand that - and since there's no way to bring these issues up untill after the patent has been granted - which means going to court ....

      The patent minefield isn't really getting any bigger ... it'sm just that the mines keep getting closer together ...

      • by Minna Kirai ( 624281 ) on Thursday December 11, 2003 @01:35PM (#7691095)
        "is it a great wonderfull new idea rather than just an incremental change that would be obvious to any engineer faced with the same problem?"

        Few of Edison's own patents meet that test. The phonograph may have been new, but the light bulb (his most famous invention, in 1879) had already been created by others as early as 1841. His own modifications were incremental. Yet of course he still got a patent.

        Other legendary inventors who did incremental changes to existing ideas (followed by the inventor who made the original, but less efficient device):
        • Sam Morse : Charles Wheatstone
        • Orville & Wilbur Wright : Samuel Langley
        • James Watt : Thomas Newcomen


        Arguably, however, patents are better given to someone who makes an incremental improvement, rather than a revolutionary one. Patents (and all of "Intellectual Property") are only meant to encourage progress. Genius, heroic inventors are quite likely to pursue their insight regardless of the prospect of patent protection- and if they succeed and earn a patent, it's likely to take a decade or more before the concept really becomes profitable. Potential competitors will be slow to recognize and accept the totally new idea.

        The phonograph and airplane, for example, both had patents granted for them, and both became huge industries (one with annual revenue in the billions, the other in the trillions). But the patents were almost expired before the business models really started to get into wide-scale profitability.

        But, an incremental improvement is more vulnerable to being rapidly duplicated. Someone prespiring away at finding the right combination of gas and filament to make the light-bulb really practical runs a true risk of someone else buying his first product and starting to sell a reproduction just 3 months later.

        A much fairer patent system would give the examiner more options than just a yes/no response. Not all inventions are inherently deserving of the same length of protection. If the government recognized this, the assignment of bad patents would be far less damaging, as only the best patents would get the long, multi-decade terms.

        Software patents especially (if they are allowed to exist at all) show last much shorter than those for physical machines. Suppose the Amazon 1-click patent had lasted for just 2-3 years. That'd be not nearly as bad as the prospect of continuing to avoid one-click ordering in 2017.
      • If I recall correctly, the "ordinary skill in the art" criterion of United States Code, Title 35 (Patents), Part II, Chapter 10, Section 103 [cornell.edu] was enacted by congress in the Patent Act of 1952 to reduce the higher common law standards of patentability, such as in Hotckiss v. Greenwood (1851).

        Personally, I doubt that any standard of patentability is high enough, duration short enough and scope narrow enough to make a patent system worth more than the value of the competition and incremental development that

    • their real customers would seem to be the [book buyers]

      Don't discount the revenue of advertisers to retailers. If Amazon is anything like most grocery/department stores, they get a lot of money for product placement. When I was just out of high school, I worked for a company that was paid to go around to grocery stores, take down a bunch of product from the shelves and put it back up in a different order. Why? Because the stores don't own the layout on the shelves - certain products do (in my case, Gi

    • It is (obviously) not hard to find bad examples of software patents. But are there any good ones?

      In my view, there should be only one rule: "Would X have been invented without the 20 years of protection from competition provided by patent law?"

      There is absolutely no reason for society to allow patents for inventions that don't pass this simple test.
      • The problem is that society doesn't decide about patterns per se. It's responibility of that part of society which benefits form it. It's called corporations. US govt is for corporations and by corporations. No chance to have a law system protecting small inventors here. Same for small developers. As for today, in USA there is no way to develop anything any usefull without either violating some patents or paying some royalties. But if a big company can afford doing both by hiring an army of emploers and kee
  • ...can be found on Pieter Spronck's aptly named ridiculous patents page [unimaas.nl]. "Scoring based upon goals achieved and subjective elements" - very nice.
  • by Brahmastra ( 685988 ) on Thursday December 11, 2003 @12:02PM (#7690210)
    It's not just that it's easy to get ridiculous patents through the Patent office. There are incentives in most companies for employees filing patents such as cash, stock options, etc. This not only inspires some people to come up with good ideas, but it also inspires a lot of people to come up with crap just so that they can get some $$$ (yeah I'm one of them too).
  • by grub ( 11606 ) on Thursday December 11, 2003 @12:03PM (#7690229) Journal

    This is going to be a giant windfall for the lawyers in all this as there will have to be an overhaul of the patent laws and system.

    Here's a prediction too: after the "fecal matter hits the rotary cooling device" in all this patent fiasco you'll see an increase in the number of people going to law school. Mainly for IP law, too. Don't laugh, remember how the non-geek masses took computer science in the 90's because that's where the money was?
    • by yoshi_mon ( 172895 ) on Thursday December 11, 2003 @12:20PM (#7690415)
      Last time I heard our law schools were turning out 1 potental lawyer for every 4 americans.

      So are more lawyer really the anwser?
      • Zapp Brannigan: You see, killbots have a preset kill limit. Knowing their weakness, I sent wave after wave of my own [lawyers] at them until they reached their limit and shut down.

        with apologies to Matt Groening and Futurama

    • by penguinoid ( 724646 ) on Thursday December 11, 2003 @12:22PM (#7690437) Homepage Journal
      Good, then they'll start outsourcing lawyers. Can't wait for the next version of Buggy Law+.
    • Hmmmm.. Thinking... EUREKA! I will patent my idea of fecal matter hitting a rotary gaseous matter acceleration device! Brilliant!
      • Good for you. I will take the patent for causing homo sapiens fecal matter to impact with a rotory gaseous acceleration device using the internet to provide initial causation. Also the process for doing the aforementioned in one click. And perhaps the process for creating (once again using the internet for research purposes) the requisite rotary device. Gotta include the Internet!

        You gave me too many ideas... too much caffeiene in my bloodstream...

        Patent the process for using the Internet as a communicati
    • Quick, somebody patent all the laws.
    • I know someone who just finished school to be a copyright/patent lawyer. He *immediately* was offered a 3 figure salary, and is now working and living in New York City.

      If only the lawyer-maiming business was so lucrative.

      Why is it when a bug is found in software it's fixed (with notable exceptions), but when bad laws are written, they're left to afflict everyone?

      It's time to Open Source law, and require politicians to be picked randomly with a term limit of 2 years.

      • by Anonymous Coward
        He *immediately* was offered a 3 figure salary

        3 figure? Was he from India?
      • 3 figure salary? He must have had a lot of trouble finding NYC property he could afford.... What do you mean by "Open Source" in this context? Laws are discussed and documented in public in democracies. Like software, most people just don't care about the details :-( I like the random politician idea, right up to the point where it just puts the power in civil servants' hands instead. They would be the persistent experts, so they would have influence out of all proportion to the random punters. Now, a ran
  • by Zog The Undeniable ( 632031 ) on Thursday December 11, 2003 @12:03PM (#7690230)
    Tim Berners-Lee must be kicking himself for not patenting the WWW. Or are there actually some decent altruistic people out there who want to make the world a better place?
  • by sirsampson ( 48252 ) on Thursday December 11, 2003 @12:03PM (#7690237)
    Posting without reading the article and without spell checking.

    What's the story about? :)
  • by saskboy ( 600063 ) on Thursday December 11, 2003 @12:05PM (#7690254) Homepage Journal
    Excuse me while I patent my DNA."

    Would that be YOUR DNA, or your clones'?
    • by peragrin ( 659227 ) on Thursday December 11, 2003 @12:14PM (#7690351)
      a better question is whether or not his parents have already patent their DNA, if so does that consitute prior art. They can easily claim to have had it longer, and it is a derviative work, of merging to to prior arts.

    • Patenting DNA? (Score:3, Insightful)

      by ThosLives ( 686517 )
      I have to say - WTF? Who do I write to about this? What the heck are they patenting? The article doesn't really say much.

      If they are patenting "hey I figured out what strand GCACTCTGATCTGTCTATATGTGT does" it's garbage.

      If, however, they figured out what sequence of nucleotides happens to build a molecular machine that does X (where X is something new) then a patent might be arguable. The *might* comes from the fact that I think they should patent the molecular machine, not the method of making it. After al

  • Comment removed (Score:4, Insightful)

    by account_deleted ( 4530225 ) on Thursday December 11, 2003 @12:07PM (#7690265)
    Comment removed based on user account deletion
  • My views (Score:4, Insightful)

    by frodo from middle ea ( 602941 ) on Thursday December 11, 2003 @12:08PM (#7690285) Homepage
    Patents are not inheritantly bad.

    Some ingenious ideas , need to be patented so that the inventor can reap the benefits of his hardwork. But inventions which leave us saying "f@#king DUH!", should seriously be quentioned.

    What USofA needs is a better patent challanging system. and by challanging a patent I don't mean claim ownership of that patent, I mean demonstrate the use of that idea so commonly in public domain, that no one actually deserves the patent.

    • Re:My views (Score:4, Insightful)

      by Brahmastra ( 685988 ) on Thursday December 11, 2003 @12:14PM (#7690349)
      I agree with you.. But on the other hand, there are ideas that leave us saying "DUH!" but until someone actually came up with that idea, no one saw it.
      • Yes that is true, but just because someone didn't see it that way, doesn't mean, no one was doing the very same thing some other way.

        Sadly the patent wordings most of the time are so vague or catch-all, that the inventor gets credit for more that he deserves.

        This is especially true for software patents

  • by overbyj ( 696078 ) on Thursday December 11, 2003 @12:09PM (#7690294)
    is that they are fishing expeditions. IANAPL (...patent lawyer) and I don't pretend to understand the intricacies of computer-related patents, but there is a fundamental flaw i the patenting world.

    For example, as a chemist, I search the patent literature trying to find out what chemical reactions have been reported. It is a well-known fact that you have to take the chemical patent literature with a huge grain of salt (no pun intended!) because many times, the reaciton simply doesn't work the way it is reported to work. The chemical patent literature is not a peer-reviewed process like scientific journals are. It is significantly harder to get an article published in the chemical literature than to patent that material.

    I guess what I am getting at, is that there is rampant patenting taking place with few significant things to show for it. Chemists patent anything and everything they can in the off-chance that someone will use it in an industrial process. They are just total fishing expeditions. I know that there will certainly be people out there to correct me with their own opinion, but in my opinion, it just points to a flawed patent system.
    • I guess what I am getting at, is that there is rampant patenting taking place with few significant things to show for it. Chemists patent anything and everything they can in the off-chance that someone will use it in an industrial process.

      One idea that could be a step toward a fix for this problem -- and it's not just with chemistry patents -- is to require that a company holding a patent actually be using that patent in a product. It's not an ironclad solution, nor does it solve all of the problems with

      • One idea that could be a step toward a fix for this problem -- and it's not just with chemistry patents -- is to require that a company holding a patent actually be using that patent in a product.

        No, I don't think this is the solution. First of all, individuals hold patents, not companies. And, secondly, often the idea for the invention requires investment for implementation.

        But I think requiring a working implementation within some liberal period, say, 3 years, after the patent is granted would be usef
  • by argoff ( 142580 ) on Thursday December 11, 2003 @12:10PM (#7690302)
    There seems to be this attitude that the suffering of slaves prior to 1850 was something that only happened back then. That it has nothing to do with now, that we are more civilized, more modern, more mature, and more sophisticated. With it comes the arrogance that what happened then, means nothing now, that what happened there has no value here, that the great torment and suffering back then can safely be ignored now as we blow off history and all the values that go with it in terms of understanding, freedom, markets, property rights, and the information age.

    Surely anyone who claimed that there is no incentive go grow cotton without "niggers" on the plantation would be considered a barbaric. But if someone claims that there is no incentive to create intellectual and knowledge works without copyrights and patents, then society calls them enlightened. If someone had said that the great wealth of America rested on slavery as a property right and the plantation system, they were a foolish idiot. But if someone says that the great wealth of societies in the information age rests on "Intellectual Property", then they are called wise. Anyone who says that slavery was about property rights and not control, is a liar. However, if they say that copyrights and patents are not about control, but "Intellectual Property" then they are considered trustworthy. How about - if you don't like slavery - don't own slaves, and if you don't like copyrights no one forces you to buy those creations. How about - if you don't believe in slavery, you must be an anarchist, if you don't believe in copyrights and patents you must be communist. How about - you are a thief if you free slaves from the plantation, you are a thief when you copy someones "Intellectual Property".

    So why are we spoon-feed these poor logical explanations over and over again? Because, like the rapist who drugs his victim and gently penetrates her, rather than beat her and tear into her where all the scars, blood, and bruises can be seen. Like the assassin who befriends and mis-places his victims heart medications, rather than pull out a rifle and pop a bullet in the head. Copyrights and patents are the pinnacle of quiet violence. So seemingly innocent, so seemingly civilized and friendly, so hard to see and identify any direct evil, any direct consequence. After all, what could be less harmless then providing an incentive to artists and inventors, right? But do they really promote art - or just promote works that have the most hype rather than the most meaning and educational value? Do they really help inventors, or do they hinder collaboration and sharing in a way that would put a police state to shame?

    Perhaps the old lady has none to blame when her patented diabetes medication is too expensive to afford anymore. Who can the workers blame when the proprietary technology they bet their career on becomes obsolete and it becomes ever harder to relearn from scratch as they get older. Who can a child in Africa blame when they are dying of AIDS, and there are no generics to treat it! Who do we blame when researchers seeking a cure for cancer encounter massive obstacles to sharing there individual research for fear that their peers will get one up on them, get a key patent, and lock them out! Who do our nations students blame when tabloids are pennies on the dollar, but textbooks dollars on the page! Who do we blame for Hollywood culture being such a failure, and so strongly influencing society in their own failed image.

    As people die because patented medicines are too costly and alternatives too sparse, and the needy go without, not because of genuine shortage, but because artificial human made restrictions. Our government who is the enemy of overt violence, has become the friend of quiet violence. Our government who has organized world wars to protect our freedoms, now promotes a world order that will take them away. The democracy that has allowed us to fight for our rights with votes and politics rather than violence and bloodshed has now become
    • And here I thought the 60s were dead.
    • by Anonymous Coward
      I find your analogy between there being no incentive without slaves and no incentive without copyright to be poorly thought out (or perhapse just poorly articulated).

      A more apt analogy for cotton with regards to copyright would be:

      "There would be no incentive to grow cotton if no one would _buy_ cotton, because they could get it for free. "

      I know that it isnt possible to get cotton for free, but you have to understand that it IS possible with regards to most copyrighted works.

      Your slavery argument when
    • interesting points! but my english professor would have burts laughing and spilled red ink all over this flowery soliloquy of abraham lincoln. "like the rapist who drugs his victim and gently penetrates her"??- jesus man, this mellodrama should impress no one but torch waving farmers at the bandstand in 1840.
    • arguments for (Score:3, Interesting)

      by ProfBooty ( 172603 )
      getting a patent or filing a patent, can at least provide some tangible property/proof of a concept, that can enable a startup or small firm to get investors, thus building their business. Its the business standpoint that most people here on slashdot don't consider.

      People may complain about abuse, but isn't it better that via the patent system, people disclose their inventions instead of hiding behind trade secrets, thus allowing others to improve upon the inital invention? I would expect that people here
      • Re:arguments for (Score:3, Insightful)

        by Halo1 ( 136547 )

        getting a patent or filing a patent, can at least provide some tangible property/proof of a concept, that can enable a startup or small firm to get investors, thus building their business. Its the business standpoint that most people here on slashdot don't consider

        If there are no software patents, investors cannot require them. It's really as simple as that. Software patents are the .com hype all over again: companies are not supposed to have a good product, good customer relationship management or even

    • I think your essay does a real disservice to the argument against copyrights and patents.

      The comparison to slavery pisses me off and it should everyone here. To put copyright/patent legislation on the same level of importance with human slavery is utterly immoral and academically incorrect. Not only does it reek of propaganda (in your next article, you might as well claim that Hitler would have supported patents), but they have zero to do with each other. From a purely economic perspective, slavery was
  • by gobbo ( 567674 ) on Thursday December 11, 2003 @12:11PM (#7690312) Journal
    If you're concerned about the dangers of rampant patenting, especially by the 'Life Sciences' sector, check out the research by the ETC group [etcgroup.org].

    They started as an agriculture research and advocacy group (RAFI) and morphed into ETC about the time they started discovering how broad the patenting system's enclosure of life forms and genetic structures was getting. It's an issue with huge implications, since ideas, biological structures, and living beings are being patented in sometimes outrageous ways [etcgroup.org].

    • So I just violated somebody's patent rights, displayed complete disregard for intellectual property by illegally replicating patented DNA sequences and in so doing brought the economy of the free world a step closer to collapse? And all this by getting my wife pregnant....

      uuuh ..... ooops ......

      Define:
      v. procreated, procreating, procreates
      v. tr.
      To beget and conceive (offspring).

      To produce or create; originate.
  • by Anonymous Coward on Thursday December 11, 2003 @12:12PM (#7690316)
    I've refused to buy any more Gillette products after their latest advert in the UK informed me in a boastful manner that their latest razor has 37(or was it 47? ) patents. For crying out loud, its a razor.
    • Any link to the patent? If somebody made a razor which uses a frickin'-lazer-beam or something similar I'd say it could be patented. Same for those electric razors which secrete foam (at least for the foam secretion idea).

      I still think the best solution is to limit how long patents - particularly IT patents - have to live. A few years of profit on innovation are fine, but a lifetime is absurd.
      • Here's a link to the Patent Office web site where I put in a query for the term "razor" in any patent with Gillette as the assignee: Gillette Razor Patents [uspto.gov] I am one of the 13 patent examiners who would ever examine a patent for a razor (among other things), so I am all too familiar with slogging through a bunch of crap to find decent prior art. As far as the 37 patent on the Mach 3, a bunch of those are design patents and another bunch are older technology that may apply to the Mach 3 tangentially at bes
  • by Dareth ( 47614 ) on Thursday December 11, 2003 @12:13PM (#7690333)
    Copyright your DNA. If you copyright your DNA then you can sue your spouse/partner for copyright infringement if they get pregnant or get you pregnant!

    Sure to insure domestic tranquility.
    • Naw, that's not a derivative work - it's fair use. Admittedly, the percentage of use of the work is high, but if you look into the precedents, I think you'll see that, at least in common law, 50% is considered customary.

      So you'd only really have a case in a situation where more than 50% of the copyrighted genes were used - e.g., a double Y chromosome or something. Even then, I think you'd have trouble getting any sympathy from a jury. Of course, with good representation, anything is possible, I guess
    • Patent your DNA. Clone yourself a few thousand times, and wait until your clones are ubiquitous and highly successful.

      Then, just as the patent is going to run out, start suing for unauthorized use of your GIF^H^H^H DNA format.
  • by GillBates0 ( 664202 ) on Thursday December 11, 2003 @12:13PM (#7690345) Journal
    Google's your friend: Totally Absurd Inventions [totallyabsurd.com]

    Categorized and arranged alphabetically in all their royal glory.

    My favorite: The Blind Spot Toy [totallyabsurd.com]:
    USA patent 4,477,3358 / Issued 1994
    It is never too early to start your Christmas holiday shopping. Why not be original this year and avoid the toys that everyone seems to be buying? Why not give the gift that keeps on giving, the "Apparatus for Aligning Image with Blind Spot of the Eye"!! Patented in 1975, this toy allows the user to locate their blind spot! In order to play this amazingly fun game, strap the toy tightly on the top of your head.

    Close your left eye and focus on the dangling tab with your right eye, then switch eyes. Voila! The dangling tab has disappeared into your blind spot. Not only will this invention provide endless hours of fun and good times for everyone (especially at parties), but anyone wearing this apparatus will unquestionably become irresistible to the opposite sex. Enjoy!

  • Rerun (Score:5, Funny)

    by tds67 ( 670584 ) on Thursday December 11, 2003 @12:15PM (#7690356)
    When Good Patents Go Bad

    This is a rerun. I saw this on Fox a couple of weeks ago.

  • Good Review? (Score:2, Interesting)

    " good review of patents in the information age"

    Is it good because it agrees with the Slashdot point of view?

    Just ask IBM, Microsoft, Amazon, what they think of patents. I doubt they'll like this article very much.

    I can already see it...-12, troll.
  • Patenting your own DNA? That's ludicrious! That's like a robot patenting it's own firmware.

    "Thanks for being my prior art, Dad. Happy Birthday."
  • Generic... (Score:3, Interesting)

    by mgcsinc ( 681597 ) on Thursday December 11, 2003 @12:36PM (#7690564)
    Generic post highlighting the fact that patents are really tested post-issuance by courts and not pre-issuance by the Patent Office...
  • Here is the trouble I have. Suppose I come up with a piece of software that can perfectly transcribe english from speech to text - accents and all, right out of the box. Shouldn't that be worth a patent?
    How about the guy with the patent on the blinking cursor? Great ideas, right? So, where does the line get drawn? Obviously, patenting something already in use is bad, but what about really obvious things that no one bothered to do yet?
    For years, Ford had to pay a different company for a patent on the internal combustion engine. They literally had to wait for the patent to run out!
  • Bigger companies find themselves prey to clever entrepreneurs like the original owners of Acacia's digital media patents, who skillfully anticipate the direction of certain technologies and then quietly wait for someone else to commercialize a related product. If they guess right, they can demand lucrative licensing fees.

    Intel's Grove derides such patent holders for showing little interest in producing goods with their inventions in favor of demanding licensing fees from others. "We call them trolls,"

  • by tigertiger ( 580064 ) on Thursday December 11, 2003 @12:41PM (#7690617) Homepage
    There is an interesting article [bricklin.com] by Dan Bricklin, one of the inventors of VisiCalc (the first spreadsheet programs), on why they didn't patent VisiCalc. It's simple - patenting software was only possible after 1981. Think what the industry would look like if people had been able to patent spreadsheets (VisiCalc), full-screen word processing (WordStar and many others before), and windowing systems (Xerox PARC and Apple Lisa).

    The bad news is that Bricklin thinks software patents are bad, but since they are here, you have to try to patent as much as possible. I guess soon we will have to take out patent-infringement insurance with premiums as high as our salaries.

  • Does this mean that I can patent my design for Sharks with Frikken Laser Beams Attached to their Frikken Heads [amazon.com]? I believe that I have prior art on this.

    How about my design for Dolphins with Frikken Laser Beams Attached to Their Fins [robertkbrown.com]?

    D. Evil

  • by Camel Pilot ( 78781 ) on Thursday December 11, 2003 @12:56PM (#7690766) Homepage Journal
    I recently modified the shopping cart on my wife's hot sauce [sammcgees.com] store to give a discount if the client is identified as Mozilla or Linux O/S. A friendly feature to encourage the use of alternative browsers (and desktop operating systems). This is the first cart with such a "feature" I know of.

    After I finished, it was a _tough_ one night hack, the thought occurred to me that some folks have patented less (ie One click shopping, local weather etc.). It demonstrated to me the need to be change the patents laws to prevent the locking up of obvious or trival application of emerging technology.

  • by syphax ( 189065 ) on Thursday December 11, 2003 @01:01PM (#7690815) Journal
    "We're focused on making sure that we're kicking out the best quality patents,"
    -- Jon W. Dudas, deputy director of the patent office

    This may explain why so many bad ones get granted?

  • Acacia (Score:5, Insightful)

    by One Louder ( 595430 ) on Thursday December 11, 2003 @01:07PM (#7690870)
    The porn guys raised the alarm on Acacia quite a long time ago but were actively ignored by the mainstream because they were "porn". Now Acacia has a few wins (and money) under its belt and is starting to go after the mainstream video streamers.

    It was a very clever strategy on the part of Acacia - first go after the porn folks (nobody would come to their defense), then the university and online education folks (no money to fight), then the broadcasters (already under siege by the trade associations), then the toolmakers. They probably could have been nipped in the bud if people had paid attention early on.

    At this point, it's important to drag the big players into the fight - folks who are being sued by Acacia need to subsequently sue the tool vendors (Microsoft, Real, Apple, Macromedia) for selling them allegedly unlicensed patented technology.

    • Does anyone know what Acacia is claiming?

      I know I developed several prototype streaming media systems at Apple in 1986-1987 that used Appletalk, and one of my coworkers did a TCP/IP port of one of these experiments. I don't how widely shown this stuff was. Farallon did a screen sharing system that is still available called Timbuktu that did streaming/multicasting too.

      I also did some object-oriented streaming media stuff at Kalieda Labs, but that was the early 90s & MPEG was already on the radar.

      -- Ja
  • by levell ( 538346 ) on Thursday December 11, 2003 @01:12PM (#7690907) Homepage
    This might be interesting if you are currently writing to your local MP (or equivalent for EU countries other than the UK) as the FFII [ffii.org.uk] are imploring you to do if you don't want the EU to pass bad software patent law. It might be an idea to mention this article in your letter as it gives an easily readable summary of what if wrong with the American system that is written by a "respected" source.

    Let's hope we get the law as the EU parliament framed it....

  • http://www.theonion.com/onion3311/microsoftpatents .html

    all the way from back in 1998, and still the all-time funniest parody on patent madness...

  • Anti - Patents? (Score:5, Interesting)

    by mhotas ( 680248 ) on Thursday December 11, 2003 @01:38PM (#7691129)
    There ought to be such a thing as antipatents. These would work like regular patents, in that they would be registered, and somebody gets to claim credit, but also disavow ownership. So whatever the idea is, it's explicitly in the public domain, and whoever claimed it first gets some positive attention. Kind of like the GPL, but not just for code.
    • The idea makes sense, but who's going to pay for antipatents? Patenting something is costly. Anti-patenting (and paying lawyers when you anti-patent is challenged in court) may be even more costly. One of the main purposes of patents is to make innovation profitable to stimulate innovation. Sure patents are wildly abused, but this was the initial idea behind them. What would be the idea behind anti-patents that would make the government want to implement this legal mechanism?
  • Business guys (Score:2, Interesting)

    by Anonymous Coward
    I've been in similar situations and the thing about patents is the drive is usually from the business guys. Mostly, it's from people with little or no technical knowledge, therefore they try to patent everything. I've been asked in the past about patents and ordered to write up patents. Business guys don't care if it's obvious. They only care about whether or not they can make money from it. In fact the patents that are more obvious are the ones they are most eager to file. Their thinking is, if it's obviou
  • by Anonymous Coward
    I think the whole problem is that we are allowing patents on IP already protected by copyright.

    The two protections were designed to be used for different purposes. copyright for IP, patents for inventions.

    When you allow both types of protection to be applied to one piece of work, the result is strangulation of innovation.

    We need to decide if software should be copyrighted, or patented. It can't be both. It isn't fair to the human race and isn't in anyone's best interest except the software companies (som
  • ...patents. Before I get flamed, let me say that the article eludes to this, but doesn't quite make the case.
    The whole purpose of the patent system was designed to provide an incentive(payment) for a company to willingly incrue the costs associated with the research and design of a new product. That incentive came in the form of a patent (guaranteed monopoly for 20 years) to recover the associated costs that went into research and design.
    In software, although there are certainly costs incrued in the f
    • Disagree (Score:2, Interesting)

      A few points...

      You've chosen a trivial example (one-click shopping) which probably should never have been awarded a patent in the first place due to its obviousness.

      Second, I don't like that term "software patent". You don't patent software, you patent algorithms and methodologies which can be implemented in software. Many of the algorithms, however, could conceivably be implemented through something other than through the running of a software program.

      The economics of developing new algorithms are no

  • by WindBourne ( 631190 ) on Thursday December 11, 2003 @04:11PM (#7692703) Journal
    It is not that patents are being granted here in the US to large companies who make large contributions to Politicians. Rather, it is the fact the we are pushing this insane approach to patents on other countries and they are actually considering it.
    We have created a monster and that should be obvious to all. Yet other nations and regions are considering it. What a nightmare.

"Confound these ancestors.... They've stolen our best ideas!" - Ben Jonson

Working...